Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CH0545
Clone ID CH0545
Vector pGT0lxr
Project sanger

Sequence tag CH0545
Sequence
CAGATATTAGGATAGTGACATCTGCTTGATTCCTAGTCTCATTTGATTTAGGTACTTTTGTTTATCTTGTCACTCCNAAG
GCACTACGGATCTTTAAAACTAAGATGTGCTGGGGAAATCTACAGACGGCGGCGGCTAAGGAAGGATGCGGCCTAGAAAT
TGCTGCTGGAAACAGGCGGCGGCTCCAATTAGGGATTCCGGAAGCAGTGTACGTGGAAGATGTAGATTCTTTCGTGAAGC
AGCCCGGGAATGAGACGGCAGATACAGTGTTAATGAAGTCCGGATGAACAATATCCAGAAGTATAAGTTTATGGAACTCA
ACCTTGCTCAGAAAAAAAGGAGGCTGAAAGGTCAGATTCTACAAATTAAACAGACTTTCGAAATTGTGAAATACATGCAG
AAGAAAAAAGAGTCTACCAATTCAATGGAGACGAGATTCTTACTGGCCGATAACCTGTACTGCAAAGCTTCAGTCCCTCC
TACTGATAAAGTATGCCTATGGTTGGGG
Sequence Type mRNA
Unitrap ID UNI3116

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 72759662..72768697 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031197 (Vbp1) NM_011692 von Hippel-Lindau binding protein 1 Gene [Source:MGI (curated);Acc:Vbp1-001]

 
Come back to gene ENSMUSG00000031197


For any suggestions or comments, please send an email to unitrap@crg.es