Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14660F6
Clone ID IST14660F6
Vector VICTR74
Project tigm

Sequence tag IST14660F6BBF1
Sequence
GTATCTTGTTAATCACAGCTGATTCTTCAGCCCCAGCTAACCAGAACCACAGAATCTTCACAATGAGACTAGCAGTGGCC
CTGAAAAAAGTCTTTAATTTTCCCTCTGAAATTTCACAAGCCAGGCCTCCATCTTCTGCACTGTTCTCAACATTATCTTC
CAAGCTCCTACACAACATTCGACAGAGCTCTTAACACAGAATGTATCTTCTGGCCCAAAGTTCCAAAGTCCTTCCACAGT
CCTCCCCAAAACCTGGTCAGGTTGTCACAGGAATACCCCACTATGCTGGTACCAATTTGTCTTAGTCAGGGTTTCTATTC
ACCCAATCCCATATTTTAAAGATGAGAATTTTATATTATATGGCTTATATCTCAATTAACAACAAGCAGCCGGGCAGTGG
ANACNCATGCCTTTAATCCCAGCACTTGGGANGCAGANGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4806732..4807168 431
NO GENE  


Sequence tag IST14660F6HMR1
Sequence
ATACCAGAACTACTATGGTGAAACCTTTGCATTACTGGGACTATTGATGCTGCTTAGCTGGAGCTAAAAAATTANCGGTG
ATTAAGAAGAGACCAGCATCATTGAGGTGACATCTTCTGGGAAGTGTTTTTTGAGAGCACAGCGGCTGTGTTCCTGANAT
AACCAAGGTTGTACCTCGTGCTACAGTGGGACTTGGTAATGTGTAAGAGTCACCCANGTGGTACTGGTTTTGAANGCNTG
AANGGGCCNCNCANAN
Sequence Type genomic DNA
Unitrap ID UNI2049

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4807165..4807417 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025903 (Lypla1) NM_008866 lysophospholipase 1 Gene [Source:MGI (curated);Acc:Lypla1-001]


Sequence tag IST14660F6HMF1
Sequence
NTNNNGGGNTAANNNNGNTGANTNNNNNNNNNNNNCNNNNNNGAACCACAGAATCNTCNNANGGAGACTAGCAGTGGCCC
TGANAAAAGTCNTTAATTTNCCCTCTGAAATTTNNCAAGCCAGGCCTCCATCTTCTGCACTGTTCTCAACATTATCTTCC
AAGCTCCTACACAACATTCGACAGAGCTCTTAACACAGAATGTATCTTCTGGCCCAAAGTTCCAAAGTCCTTCCACAGTC
CTCCCCAAAACCTGGTCAGGTTGTCACAGGAATACCCCACTATGCTGGTACCAATTTGTCTTAGTCNGGGTTTCTATTCA
CCCAATCCCATATTTTAAAGATGAGAATTTTATNTTATATGGCTNATATCTNANTTANCAACAAGCAGCNGGGCAGTGGA
GACGCATGCCTTTNAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000025903


For any suggestions or comments, please send an email to unitrap@crg.es