Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10073A3
Clone ID IST10073A3
Vector VICTR75
Project tigm

Sequence tag IST10073A3BBR1
Sequence
ATTTGGTAGGATGCGATGTGTATAAGAGAGATCCCCCTGCACATCTGGCCCTTGTGGTGTTTCAAAAAAGAAACAAGGAT
TTTAAAATAACTCAAGGAAGATCAGGGTTGGCTTGTAAGCCCCTGGGGAGGCTGCTCTCTCCCCTCCAGCAGCGGTATTG
GACTTAGCTGCTCAGCAGAGATGGGACGTGAGACCTTGGCCAGTGTAGAAGGGTGGTTAACAGTGAGACTTACTGTTAAT
TAAGTTTATGAGTTAGGAATCAATGTTGAACCATAAAGTGAAACTAACTGGAACCATATCTGTCTCTCTGTCTATGCAAC
CAGTAAACAATCAATTAGGGAGGCATCAGTTTACTTTGCGCTAGGCACGGAAACTGCTATTGCGGAGCAAATGAGAACTG
GTGTCTGAACACACAGCTTTTGATCCAAAGGTTGTGCTAGGTCCACACTGTGCAGGGCTCCCTGGCAAGGAACCTAGGCT
CCGGAGATAGCTTTTCAGATACTGTGCTGGGCAGTTTGAAGTGGGGAGGCAGGGGTTCCTTGTATCTCTTTGTGAGGAGG
ATTAAGGAAGCCTTGATAAAAGAGTCTGTCTTTAAATGGTAC
Sequence Type genomic DNA
Unitrap ID UNI7564

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58089965..58090566 598
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036986 (Pml) NM_178087 promyelocytic leukemia Gene [Source:MGI Symbol;Acc:MGI:104662]

 
Come back to gene ENSMUSG00000036986


For any suggestions or comments, please send an email to unitrap@crg.es