Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10544F3
Clone ID IST10544F3
Vector VICTR76
Project tigm

Sequence tag IST10544F3BBF1
Sequence
TTATCACAATAGGTGAATGCATTTANTAATTCCCTACAGTTTAACAATTAANAACACCTGGAAGCCTTTCANATTGGCTA
AAATGTTCATCTGAATAAGGTTCCCTGTCTAAACCACTTCATGATGAGACATCTGGGCAATANCTGATACATTTTTATAC
AATATTATGGATGATCTTGATTTCTTATACTCCCCATCTANGGCTTTAAAAGCCAAGCAAGGGCTANGTGTGGTGGCACA
CACTTTTNANCTNANCCNTGGNGAGGCANAANGANACANATGTCTATGANTTCAAGGCTANCCTGCTCTACATATTGAAT
TCCANGACAGCCAGGTCTACATAAAACANGGGTTCTCAAATGCTACAACTCTTTATACAGTTTCTCATGTTGTGGTAANA
CCCANCNNTAAAATTATTTTTATTGCTATTTCATAACAATNATTTTCCTACTTATGAATTGTAATGTAAATATCTGATGT
GCNNATGGCCTTNNNANNNCCTTTGTGAANNGTNNNTTTGTCTCCCCNNGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10544F3HMR1
Sequence
CCATGTCTTAGGAACAAATACCATTTNNTATTCGTCTTGAGAGACATCTTAAATAGCTACATCAGATGCACAAAACCCAT
GAAAAGTCTAGCATTGAGTAGATCCTCAAATGGGAGCTTGTTTACAGAGCTGGAGCCAGAAGTGGGAGCCCCACCCTGTC
TGCCTCAGCTCCAGGTACTCACTCGCTAACTCCTACTGTGGACCCTCTGCGTGTATCCACAAATAACCNCGGACATTCTG
AATGTTC
Sequence Type genomic DNA
Unitrap ID UNI29651

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42271049..42271295 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037287 (Tbcel) NM_173038 tubulin folding cofactor E-like Gene [Source:MGI Symbol;Acc:MGI:1925543]

 
Come back to gene ENSMUSG00000037287


For any suggestions or comments, please send an email to unitrap@crg.es