Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST456677
Clone ID OST456677
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST456677
Sequence
ACCTTATGGATTCTATCGTGAAAAATGTTGGAAGAGAATATCTCACTGCCTNTACTAAAAATCTAGTTGCAACATTTATT
TGTGTGTTTGAAAAGGTGGATGAAAATACTAGAAAAAGTTTATTTAAATTACGTTCCACATGGGATGAAATATTCCCTTT
GAAGAAACTTTATGCCTTGGATGTCAGAGTCAATTCATTAGATCCTGCTTGGCCTATTAAACCTCTGCCTCCTAATGTGA
ATACATCTAGCATCCATGTGAATCCCAAATTTTTAAATAAATCGCCTGATGAGCCTTCAACACCTGGCACAGTGGTCAGT
TCCCCCAGTATCTCCACTCCTCCCATTGTACCTGATATACAAAAGAATCTTACCCANGAACNNCTAATATGGCAACAGTT
ACTGGC
Sequence Type mRNA
Unitrap ID UNI14426

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 99812045..99814344 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041328 (Pcf11) NP_083354 cleavage and polyadenylation factor subunit homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Pcf11-001]

 
Come back to gene ENSMUSG00000041328


For any suggestions or comments, please send an email to unitrap@crg.es