Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14518C10
Clone ID IST14518C10
Vector VICTR74
Project tigm

Sequence tag IST14518C10HMF1
Sequence
GTCTGAAGACAGCTACAGTGTACTCATATAAATAAAT
Sequence Type genomic DNA
Unitrap ID UNI23688 UNI35883 UNI35884 UNI35885 UNI35886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 60822850..60822886 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 89158515..89158551 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 5161106..5161142 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 21841710..21841746 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 100549330..100549366 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037280 (Galnt6) NM_172451 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 Gene [Source:MGI Symbol;Acc:MGI:1891640]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 13455042..13455078 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021306 (Gpr137b) NM_031999 G protein-coupled receptor 137B Gene [Source:MGI Symbol;Acc:MGI:1891463]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 12956484..12956520 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78258481..78258517 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 8046212..8046248 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28089719..28089755 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 117280426..117280462 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 93371245..93371281 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 47730525..47730561 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87296711..87296747 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3371780..3371816 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040274 (Cdk6) NM_009873 cyclin-dependent kinase 6 Gene [Source:MGI Symbol;Acc:MGI:1277162]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 32674272..32674308 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 41428149..41428185 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7385176..7385212 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031153 (Gripap1) NM_207670 GRIP1 associated protein 1 Gene [Source:MGI (curated);Acc:Gripap1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 10651923..10651959 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 39348424..39348460 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026077 (Npas2) NP_032745 neuronal PAS domain protein 2 Gene [Source:MGI Symbol;Acc:MGI:109232]


Sequence tag IST14518C10HMR1
Sequence
AGCACATACNNNAAGAGGGCTTCANATCTCATTACGGGTGGTTGTGANCCNCCATGTGGTTGCTGGGAATTGAACTCGGG
ACCTCTGGAAGAGCTCTTACCCCCTGAGCCATCTCTCCAGCCCCGTTTCAGAGGTTTACTCCATTATCGTCATCGTGGGA
AGCACAGCTGCGTGCANGCANACATGGTGCTGAAGAAGGAGCANAGAGTTCTGCATCCTGATCTGAAGGCAGCAGAANAA
GATTGTGTTCCNTACTGGGGGAAGCTTGACTTCNNNNTTTGCCCNNNCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000026077


For any suggestions or comments, please send an email to unitrap@crg.es