Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST456641
Clone ID OST456641
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST456641
Sequence
GAACTGAGGCGGTCCTTGCCCGGNCACGTNATGTTGTNCCANCTCCGGGCGNAAGCCCGCGGGTAGCGCGCAGAGTCCCG
CTGNNAAATGGNGTGCTGCATCGNGGTGCANCTGCGCCCNCNAGCAGGCTGTANNGCCCTTGCNACCCTGNTCCCGATGG
TCCCTTACCATGAGGCCGNTGAGTCGCCGAANCCATGGACATGGACTTACTCCCTGTTGCTCCTTGCAATCGTCTTGCTC
TCTTGGGGATTCGTCATCTATGCATCGACTGTAGCTGCACGACGACAACTACAGAAGGAGTTTCCAGACAAGTTCTTCTG
AACGAACTTTTGTAATTCTTAGCAAACACTTCTTTTCTTCAGATGGCACCTATGTAGACTCAAAGTAAAATTCACA
Sequence Type mRNA
Unitrap ID UNI13990

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40216548..40217250 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028407 (2010003O02Rik) RIKEN cDNA 2010003O02 gene Gene [Source:MGI Symbol;Acc:MGI:1913684]

 
Come back to gene ENSMUSG00000028407


For any suggestions or comments, please send an email to unitrap@crg.es