Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14185G10
Clone ID IST14185G10
Vector VICTR74
Project tigm

Sequence tag IST14185G10BBF2
Sequence
GCCTCCATGAGATCCAACTGTAAGGCATTTTCTCAATTANTGATCAAGGGGGAAAGGCCCCTTGTGGGTGGGACCATCTC
TGGGCTGGTAGTCTTGGGTTTTATAANAGAGCAGGCTGAGCAAGCCAGGTGAAGCAAGCCAGTAAAGAACATCTCTCCAT
GGCCTCTGCATCANCTCCNGCTTTCTGACCTGCTTGAGTTCCANTCCTGCATCCTTTGGTGATNNNCAGCANTATGGAAA
TGTANNCCNAATAANCNNTTTCCTCCCCAACTTGCTTCTTGGTCATGANGTNNGTGCNNGANTANAAANNNTGACTAANA
CACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14185G10HMF1
Sequence
GCCTCCATGAGATCCAACTGTAAGGCATTTTCTCAATTAGTGATCAAGGGGGAAAGGCCCCTTGTGGGTGGGACCATCTC
TGGGCTGGTAGTCTTGGGTTTTATAAGAGAGCAGGCTGAGCAAGCCAGGTGAAGCAAGCCAGTAAAGAACATCTCTCCAT
GGCCTCTGCATCAGCTCCTGCTTTCTGACCTGCTTGAGTTCCAGTCCTGCATCCTTTGGTGATCAACAGCAGTATGGAAA
TGTAAGCCGAATAAACCCTTTCCTCCCCAACTTGCTTCTTGGTCATGATGTTTGTGCAGGAATAGAAACCCTGACTAANA
CACCTGGCTATCCTATAACTCACTCTGTANACCANNCTGGCCTGATAAGAGATCCAACTGCTTTTGCCTCNNGANAGTGC
CNNAANTAAAGGCCTGTGTAACTACGTGTGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 172802840..172803270 411
NO GENE  


Sequence tag IST14185G10HMR1
Sequence
GAGGCATTTCCTCAACTGAAGCTCCTTTCTCTGTGATAACTCCAGCTGTGTCAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI33950

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 69831919..69831976 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 31244076..31244133 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14432599..14432656 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056296 (Synpr) NM_028052 synaptoporin Gene [Source:MGI (curated);Acc:Synpr-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 68504801..68504858 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 150234845..150234902 58
NO GENE  

 
Come back to gene ENSMUSG00000056296


For any suggestions or comments, please send an email to unitrap@crg.es