Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14258D6
Clone ID IST14258D6
Vector VICTR74
Project tigm

Sequence tag IST14258D6HMR1
Sequence
ACGACACAGTCATATTCTGAAACGTTGTAAAGTCATTCAGTAGTAGGAGTCGAATCTCCTGGTAACTTGGAAGGATTTCT
AAGTCTATCCTGAGAGGATTTCCAATCTGTTCCTTATGTGATAAAGGTAAAATATAGAGAAGCGTATATAATAGTCTATT
TTTATAAAGCTATATGTAAGACATGAGTTTTATGTGTCCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI29730

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 44132372..44132574 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052459 (Atp6v1a) NM_007508 ATPase, H+ transporting, lysosomal V1 subunit A Gene [Source:MGI (curated);Acc:Atp6v1a-001]


Sequence tag IST14258D6BBF1
Sequence
GTCGTAATAAGCATAATACTTCTAATAGGTGTTCCCCTGTTCTCAGGATTTTAGCACTGTCACCACTGTGGCAATCAACA
TCCAAGTCAACAGGTTTTTGCTTGCTTACTGGTGATTTTATTTCATGGAGGCTGATGAAAGAATACATACACTTCTAATA
CTAATACTGTTTGCTTACAAAGCAAAACAAAACCAAGGAACAATTCATTTCTCTATCAGCTTTCAAGGGAATCTTCTCCC
CACATATCCCTGCTAGCATGGTTTATCATTTATTTTTTTACTANCCAGAGACATANTAATTCACTGTTACTCTATCAATT
GCTANTAANGTTATAGTTTTCCCATTTGTTAANCTAANTGTTAAATGTNNANCTTTTTCTCCTGTGAACTTCTGACCACA
TCCTTCTCTATAATTGGTGGACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 44132570..44132991 404
 
EST/CDNA Est Name
  AI226883.1 - AI791057.1 - DV039507.1 - CF906752.1 - CN684784.1 - CN669825.1 - CX732171.1 - BG172575.1 - BI555036.1 - CO431826.1 - CJ138739.1 - CK618281.1 - CF742420.1 - BG342579.1 - CK621379.1 - CF906805.1 - BF167896.1 - CA893582.1 - CF897603.1 - CA881917


Sequence tag IST14258D6HMF1
Sequence
GTCGTAATAAGCATAATACTTCTAATAGGTGTTCCCCTGTTCTCAGGATTTTAGCACTGTCACCACTGTGGCAATCAACA
TCCAAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 44132570..44132657 88
NO GENE  

 
Come back to gene AI226883.1 - AI791057.1 - DV039507.1 - CF906752.1 - CN684784.1 - CN669825.1 - CX732171.1 - BG172575.1 - BI555036.1 - CO431826.1 - CJ138739.1 - CK618281.1 - CF742420.1 - BG342579.1 - CK621379.1 - CF906805.1 - BF167896.1 - CA893582.1 - CF897603.1 - CA881917


For any suggestions or comments, please send an email to unitrap@crg.es