Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13546B5
Clone ID IST13546B5
Vector VICTR74
Project tigm

Sequence tag IST13546B5HMR1
Sequence
ATATGATCCAACGAGGACAACGCTTTTGTGTTAGAGGCCATTCAGTAAAAGTTGAACGTGCTAATTCTTTTACCATAGAG
TTGAATACTTAAATATAATCGTTGGATAGCGATTTCTTTCCTTATACGAGGTGGATATTGAAATGTATTCAGCGCTCATA
CATGACTCTTGGAATTCTTAAGTCTGCCGAATACTGCCTGTTTTGCAGATACTATTGTAGTAACATTTACTTAACGAAGT
TTCTTTAACTAGCATGCAACTTTGTAACCAGGATTTAAGGAATTCCAATTACATTTGAATCATAGTCGAAAAATAAACTT
GTGGTTCATTTTGGGGAACACACTGTCTAATGGCGAAATCCAACTTACTTGAAAAATGACAAGATCAAACGTGTTGGGTT
TCTTGCGGAAATAAGTAACACTCAAAGATGACAATTTTGAGTGGGAATTGTCCTCTTGANATAGTTCCTTTTACTTTANA
AACNTACTAGTATATATGTATTTNGCCTTTANAAAANNTGCTTANCCTANCCTGTTGNNTATANNGTTCTACTTTAAAGT
CNATTCTTTANTTTTATGTAGGAGTAANTN
Sequence Type genomic DNA
Unitrap ID UNI14270

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44179526..44180113 554
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035696 (Rnf38) NM_001038993 ring finger protein 38 Gene [Source:MGI (curated);Acc:Rnf38-017]

 
Come back to gene ENSMUSG00000035696


For any suggestions or comments, please send an email to unitrap@crg.es