Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13054H4
Clone ID IST13054H4
Vector VICTR76
Project tigm

Sequence tag IST13054H4HMR1
Sequence
AAACTGGTCTATTGCAGGACCTGGCCGCTGTGTAAGCAAAGGAGGGCTTGGCCGGCGTCCGCCTCTAGCTCGAGTAAGGG
TGGCTGTGCGGCTGCGCCCGTTTATGGATGGAGAGACAGAAGCGAAGGAGCTCCCCTGTGTCCGAGCCATANACAGCTGC
TCTCTTGAAGTGGCTAACTGGAAGAAATACCAGGAGACGCTCAAATATCANTAAN
Sequence Type genomic DNA
Unitrap ID UNI221

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134179258..134179471 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030677 (Kif22) NM_145588 kinesin family member 22 Gene [Source:MGI Symbol;Acc:MGI:109233]

 
Come back to gene ENSMUSG00000030677


For any suggestions or comments, please send an email to unitrap@crg.es