Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14273B9
Clone ID IST14273B9
Vector VICTR74
Project tigm

Sequence tag IST14273B9HMR1
Sequence
NTNNGCACACTGTGCTCCCTTCTCANCTGTTTGATTTTTTTTTTTTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8825068..8825110 41
NO GENE  


Sequence tag IST14273B9HMF1
Sequence
TTGTGTGCTGACCTTAAAGTACAGCTACTCTCGAGGATTGTTTGAACCAAGGAGTTCAAGACAATGACATCAGACCACCA
TGATCTGCTATGTGGATGCTGGGAATTGAACTCAGAACCTAAGTGAG
Sequence Type genomic DNA
Unitrap ID UNI27189

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8825105..8825229 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010110 (Stx5a) NM_019829 syntaxin 5A Gene [Source:MGI Symbol;Acc:MGI:1928483]

 
Come back to gene ENSMUSG00000010110


For any suggestions or comments, please send an email to unitrap@crg.es