Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CD0259
Clone ID CD0259
Vector pGT0lxfT2
Project sanger

Sequence tag CD0259
Sequence
AGGCCAAGTACGCCCCACTTCACCTGGTTCCCCTGATAGAGCGGCTGGGGACGCCTCAGCAAATCGCCATCGCTCGGGAG
GGTGACCTGCTGACCAAGGAGCGGCTCTGCTGCGGCCTGTCCATGTTTGAGGTCATCCTGACCCGAATCCGGAGCTACCT
GCAGGACCCCATCTGGAGGGGCCCGCCACCCACCAATGGCGTCATGCATGTGGATGAGTGTGTGGAGTTTCACCGGCTGT
GGAGTGCCATGCAGTTTGTCTACTGTATCCCTGTGGGGACCAACGAGTTCACAGCTGAGCAGTGCTTCGGTGACGGCTTG
AACTGGGCCGGCTGCTCCATCATTGTCTTGCTGGGCCAGCAGCGGCGCTTTGACCTGTTTGACTTCTGTTATCATCTGCT
GAAGGTGCAGAGGCAGGACGGGAAGGATGAGATCATTAAGAATGTG
Sequence Type mRNA
Unitrap ID UNI3119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 46012493..46020947 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020340 (Cyfip2) NM_133769 cytoplasmic FMR1 interacting protein 2 Gene [Source:MGI (curated);Acc:Cyfip2-001]

 
Come back to gene ENSMUSG00000020340


For any suggestions or comments, please send an email to unitrap@crg.es