Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14262D4
Clone ID IST14262D4
Vector VICTR74
Project tigm

Sequence tag IST14262D4BBF1
Sequence
GGATGGCTGCGCAGATACAGGAAGAGCGGCCACTAAGACCTGTGGGGAAAGGAACCGGTCTTTGGGGCCTGGGATGACTG
GGCAGGAAGCTCACCCGGGGTCTGTAACAGTTCGGGATCACGTTTCTCTCCTTCTCACTTGGCCAGTTAAGGAATTAATT
CTTCCTTTTTTCTTTGTCTTTCTTTTCCATGCCTGTGTGTGCTCTCTGGACAGCTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI32404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 103834063..103834282 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046085 (4931422A03Rik) RIKEN cDNA 4931422A03 gene Gene [Source:MGI Symbol;Acc:MGI:1918236]


Sequence tag IST14262D4HMF1
Sequence
GGATGGCTGCGCAGATACAGGAAGAGCGGCCACTAAGACCTGTGGGGAAAGGAACCGGTCTTTGGGGCCTGGGATGACTG
GGCAGGAAGCTCACCCGGGGTCTGTAACAGTTCGGGATCACGTTTCTCTCCTTCTCACTTGGCCAGC
Sequence Type genomic DNA
Unitrap ID UNI32404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 103834137..103834282 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046085 (4931422A03Rik) RIKEN cDNA 4931422A03 gene Gene [Source:MGI Symbol;Acc:MGI:1918236]

 
Come back to gene ENSMUSG00000046085


For any suggestions or comments, please send an email to unitrap@crg.es