Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14715H5
Clone ID IST14715H5
Vector VICTR76
Project tigm

Sequence tag IST14715H5BBF1
Sequence
CTGAACACTGAGAACAATATGTTTCACTGTAAATTTCAAAAATCACTTGGTAATATAAGGGTTCTGCTGTTGTGTTTCAG
CAAAGGACAAAACAATCCCACAAACCAGCTCCTGAACCCAGTACCCGCTCTGCCATGGCTTCCTAGCCCCACGCCCAAGC
ATACCTCAGTTTCCTCATTTANCCCAGCTGGGGTGCAGCGGCCGGCCGAGCTGAGACTCCCTGCTGGCCCCGAGGCCAGT
CTCCAGCACACCTTTATCTTATCTAAACTTACTTTGTTTCTCCTGGGGGAATGAAGACAGCTTTCTTGCCCTCACAGAAG
ANATGACCGCCTTCTCAGGGCAGGGTTCATCCAGAAGCANCNATTAACCCCTGGANAAAACTAGCTTTTCCTCTANTCTG
CCCAACCNANTTGAGGAAAANCCNNNNTTGGGGCATTCGNCTGTGANNNTGCTTCTACAATGTACAGGTGTGTNANACTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13195768..13196246 441
 
EST/CDNA Est Name
  AI036168.1 - BG080074.2 - BF786829.1 - BQ256776.1 - BY707909.1 - BB642388.1 - BF118651.1 - AW744229.1 - CF622620.1 - BE303556.1 - BM506951.1 - BY050156.1 - BY043128.1 - BY054928.1 - BY058992.1 - BY037482.1 - BY052976.1 - BY287449.1 - BY038377.1 - BY058115


Sequence tag IST14715H5HMR1
Sequence
TTCNGGTTTAGGATTTTAGACAAATAGCTAAAAAAGTTTAAATTCAAACCAGAGCCAGGGTGACTGACTCCTTTCACCCC
AGTTCTTAGGAGGCAGAGACAGGAGGCTTGCTAGAAGTTTGAAGCCAACCTGGTCTACATAGAGATCCCATTCTAGGCCT
ANAAC
Sequence Type genomic DNA
Unitrap ID UNI18589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13195609..13195772 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038515 (Grtp1) NM_025768 GH regulated TBC protein 1 Gene [Source:MGI Symbol;Acc:MGI:1914040]

 
Come back to gene ENSMUSG00000038515


For any suggestions or comments, please send an email to unitrap@crg.es