Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10130F12
Clone ID IST10130F12
Vector VICTR76
Project tigm

Sequence tag IST10130F12BBF2
Sequence
CACTCCTAAGCTGGCTCTGCCTCTGGAGGGCTGGGATTAAAGGCATGTGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 130195360..130195402 43
NO GENE  


Sequence tag IST10130F12BBR1
Sequence
AGGAGGTCATATTGTGGTTTTGAAAGATCAAGCCCTTTACTGCCCACATCCCCACAAGTGTGAATGAAAGGGACTAGCAT
TCCGGAACAGGAATATAGGCCCTCCTACTCTCCTAGCAATGTTAGATATTGACCTAATGTGCAAAACATTATGTATATTT
TTTTAAAACTAAATTTAGTAAGGGTTACTGGACTTAATCCTATTCCAGGAGTGTTATCGTTAAGAAGATCC
Sequence Type genomic DNA
Unitrap ID UNI23118

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110016858..110017087 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032480 (Dhx30) NM_133347 DEAH (Asp-Glu-Ala-His) box polypeptide 30 Gene [Source:MGI Symbol;Acc:MGI:1920081]

 
Come back to gene ENSMUSG00000032480


For any suggestions or comments, please send an email to unitrap@crg.es