Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12581A8
Clone ID IST12581A8
Vector VICTR76
Project tigm

Sequence tag IST12581A8HMF1
Sequence
CTGTGCAGAAAACAAAGCAATGTAAAAAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI35890

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4786726..4786759 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053550 (D430041B17Rik) NM_172737 RIKEN cDNA D430041B17 gene Gene [Source:MGI Symbol;Acc:MGI:3605641]

 
Come back to gene ENSMUSG00000053550


For any suggestions or comments, please send an email to unitrap@crg.es