Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0123
Clone ID CC0123
Vector pGT0lxfT2
Project sanger

Sequence tag CC0123
Sequence
TCTAGTTCTGCCCACCACATCACACCCTTGAAAGGAAATAGTACAGAAACCAGAGACCCAGGCGATGGAAAAGGCTCCCC
CAAAGATGGTATCATGCCTCTTGATTCAGCCTCTCCTGAAGATGAAGTACACATCTGTAATCTCAGTTTGGGAGAGGATT
TTAATGTAGAAAAGTCTGTAGAAGAAAAGGAGAACATAGCCACAGGATATAGTGAAAGTGTTAAAAATGGACCAGGGCGG
CCAGATCCTTCAGACAGCTCTTGCGAAGGCCTTGTCAGACCTCAGCAGAAACCAAAGAAAAGTGAGAAAGAAGAAAAG
Sequence Type mRNA
Unitrap ID UNI3124

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 18632427..18641665 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039842 (Mcph1) NM_173189 microcephaly, primary autosomal recessive 1 Gene [Source:MGI (curated);Acc:Mcph1-001]

 
Come back to gene ENSMUSG00000039842


For any suggestions or comments, please send an email to unitrap@crg.es