Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST456334
Clone ID OST456334
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST456334
Sequence
GACTGGGTTCATTTTGACGCCAACNCCTCGGTCCTTCATGATGAATTCATCGCGCACAGGCTTGGTTTAATCCCCCTCAC
TAGTGATGACATTGTGGACAAGCTGCAGTACTCCCGGGACTGCACATGTGAAGAGTTCTGCCCTGAGTGTTCTGTGGAGT
TCACTCTCGATGTGAGGTGCAATGAAGACCAGACGCGCCATGTCACCTCCCGAGATNTNATCTCCAACAGCCCCCGGGTT
ATTCCGGTGACATCTCGGAACCGGGATAACGACCCTAATGACTATGTGGAGCAGGATGACATCCTTATTGTCAAGCTGAG
GAAGGGGCAGGAGCTGAGACTTCGAGCCTATGCCAAGAAGGGCTTTGGCAAGGAACATGCCAAGTGGAACCCTACTGCGG
GGGTAGCTTTTGAATACGATCCAGACAACGCACTTAGGCATACAGTGTATCCCAAGCCTGAGGAATGGCCCAAGAGTGAG
TATTCCGAGCTGG
Sequence Type mRNA
Unitrap ID UNI16652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97384149..97386735 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031783 (Polr2c) NM_009090 polymerase (RNA) II (DNA directed) polypeptide C Gene [Source:MGI Symbol;Acc:MGI:109299]

 
Come back to gene ENSMUSG00000031783


For any suggestions or comments, please send an email to unitrap@crg.es