Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12840A3
Clone ID IST12840A3
Vector VICTR76
Project tigm

Sequence tag IST12840A3HMR1
Sequence
ACTCTTANTTCGGAGTACTTATTANNATCNCATANTCAGAATGGCTGGCTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12840A3HMF1
Sequence
ACATCATCCACTAAGTCTGGATTTGAACTTGGGCGTCTGACACAGTCTAAGCTGCCCTACCTGTCTGTGTTCTGATGGCA
GGTTTCCTGCGCTTGCACAACCTTGAAGCTTCTCCAGGCTCAGGATGGCCCTCTCTCTGGGTCTCTGACTGTACTTTCCT
TTGTTTTCCTTTGAAAACAGCACAGACTGGGAGCATTTGTTTTCCTAGGTGGGTTCATTTGCATTGCCTTAGGTAAATTA
GCCTTGCTATCTANTCTTGCTTGTTTAATGGGAGCAAGTCTACAGGCCAATAAAAATAGGAATGGAGGAAGCAGCCTANC
AGAAGGAAGAAGGGCAGAGCTCTGTGGCTTGTTGAGATGTGGGCTGGGTGCGATGTTTTCTACCTTACTTCCTCCCAAAA
TAAAGCAAAACAAAATTCCACAAGCNNGTTCCNGANCAGTTTGTTCTGTCNTTTTAAAAAAGTGGTTAAATACCTTTAGT
ATCTCAATGTTGGCATAATNNTTGTTTTGTGAGANAATATTGTANACTTTNNGTGAAATGTTTGNNATCTCTCTCCCAAA
CAGANCTGN
Sequence Type genomic DNA
Unitrap ID UNI35893

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93227022..93227589 536
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]

 
Come back to gene ENSMUSG00000029381


For any suggestions or comments, please send an email to unitrap@crg.es