Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST456267
Clone ID OST456267
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST456267
Sequence
ACAGCTTTAACGCGCCGTACTCCAGGGACAACCCACAGCTGCACGCGGAAGTGAAAGTCTGGGTGAAGGAACAGAAGGTC
CAGGAGATTTTTATGCAAGGTGAANATATNGNNATTNCATCACCGGCGAAGGCCTNGTGCCAGTNAAAATATCANCNCTG
TNCACGNTCNTTNTACACNTGCTCAAGCAAATAGTNCCAGACCANCCAANGAACTCTNANGCGNGCTGTACCAAAACAGA
AGCACACCATACGT
Sequence Type mRNA
Unitrap ID UNI569

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66678028..66681107 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]

 
Come back to gene ENSMUSG00000037876


For any suggestions or comments, please send an email to unitrap@crg.es