Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10068G3
Clone ID IST10068G3
Vector VICTR75
Project tigm

Sequence tag IST10068G3BBF2
Sequence
GCAGAATTGGGCATCAGATCCCATTACAGATGGATGCGAGCCACCATGTGGTTGCTGGGAATTGAACTCAGGTTCTCCGG
AAGAGCAGTCAGTGCTCTTAACCACTGAGCCATCTCTCCAGCCCCAAGATTTATTTTTACTCATGTGTACAAGTGTTTTA
TCTGCATGCATGCCTGTTTGTGCAGCGCCCATGGATATCAGAAGAGGGTGTGAGATATCCTGGAGCTGGAGTTAGGGACC
CTTGTGAGCAACCATGTGGATGCTGGGAATCAAATCCAGGCTCTTTGCAAGAGCAGCAAGCTATTAACTGCTGAGCCATC
TCTCCAGCCCTAATATACACATACATGTATGCAATGTATTACAAATTGTGTAATATATTGCACATACATGTATATGTATG
TATACACACACATACACGCACAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78815012..78815438 427
NO GENE  


Sequence tag IST10068G3BBR1
Sequence
TTGTGTCCCCCAAATGTTCAAGACACCGGTTCGTGAGTTCGTGAGAAGCACTAGGGTATGAAGCAGATCC
Sequence Type genomic DNA
Unitrap ID UNI22412

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8913308..8913376 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023156 (Rpp14) NM_025938 ribonuclease P 14 subunit (human) Gene [Source:MGI Symbol;Acc:MGI:1914303]

 
Come back to gene ENSMUSG00000023156


For any suggestions or comments, please send an email to unitrap@crg.es