Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14889E10
Clone ID IST14889E10
Vector VICTR76
Project tigm

Sequence tag IST14889E10HMR1
Sequence
AACAAAGCACATAGGAGCAAGTTCAAATACTATCTTATTAATGCCATTTATTCTACGAGGAAGAGCATGATCTTTTTCAA
ATCAGTACAGTAATATATTTTTTCAGTTATTTTTATCTTTTTAAAAAGTTATTTTTTGGTACTACTTTTTAAATTTCATT
TTCACTATCCNTACGTGACCTCTTACATGTTTCTGTTCTCCAATATTGACCCCNAATTAANAATATCATTCCTATTTTTA
AAGAGATTN
Sequence Type genomic DNA
Unitrap ID UNI6522

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177572073..177572320 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078863 (OTTMUSG00000016325) predicted gene, OTTMUSG00000016325 Gene [Source:MGI Symbol;Acc:MGI:3702875]

 
Come back to gene ENSMUSG00000078863


For any suggestions or comments, please send an email to unitrap@crg.es