Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12282E9
Clone ID IST12282E9
Vector VICTR76
Project tigm

Sequence tag IST12282E9BBF1
Sequence
ACTTCTCGCAACTCCTTCCTGCACCCACCAGAAACATAGACTCTAGTTTGTGTGGGCCAGCTGCTCTGAGCGTGAGGTCT
GCTCTGAGCATGCTCGATGTACCCAACGCCACTTCCTGCTACCCTCTCTAGCAGCCACCAATCGCAAACAGCCTCTTGTA
TGGGGGCGGGACTTTGTACGCTCCTTCCAGTTCTCCATTCTGGGATTTGGGATTTTCCACTCTGTGATTTCTGGGCGTTT
GCTCCGTTGTGAGTGCTGCATGGCTTTTGCACTACCAGAGCGTCTCGTCCGCTCCGTCGGTTCAGACCGAAGCTCTTTGT
TTAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI16301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 120073033..120073361 329
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032517 (Mobp) NM_008614 myelin-associated oligodendrocytic basic protein Gene [Source:MGI Symbol;Acc:MGI:108511]


Sequence tag IST12282E9HMF1
Sequence
NNTTCTCGCAACTCCTTNCNGCACCCACCANAAACATANACTCTAGTTTGTGTGGGCCANCTGCTCTGAGCGTGAGGTCT
GCTCTGANCATGCTCGATGTNCCCNACGCCNCTTCCTGCTACCCTCTCTANCAGCCNCCAATCGCAAACAGCCTCTTGTA
TGGGGGCGGGACTTTGTACGCTCCTTCCAGTTCTNCATTCTGGGATTTGGGATTTTCCACTCTGTGATTTCTGGGCGTTT
GCTCCGTTGTGAGTGCTGCATGGCTTTTGCACTACCAGAGCGTCTCGTCCGCTCCGTCGGTTCAGACCGAAGCTCTTTGT
TTAAGATCTTTGCTGATGTAGTAAGAAGCGCATTGCATTCACGACTTCCAGAAAGCCTTGTTTCTTTATGGCGTAGATCT
TTTCGATTACAGTCTTTTCCTTTTATNATCTATGCAGCTCCAAATTTCTCCCATAGAAATTTTGACATTTTAGTTTTCTC
TTTATTTCTGGGTATTTCANGATTTTGTTGCTGTTGTGAANATATN
Sequence Type genomic DNA
Unitrap ID UNI16301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 120073035..120073557 493
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032517 (Mobp) NM_008614 myelin-associated oligodendrocytic basic protein Gene [Source:MGI Symbol;Acc:MGI:108511]

 
Come back to gene ENSMUSG00000032517


For any suggestions or comments, please send an email to unitrap@crg.es