Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11272E7
Clone ID IST11272E7
Vector VICTR76
Project tigm

Sequence tag IST11272E7HMR1
Sequence
TGTCCACCATGTGGGTCCCAGANAACAAACAGAGCTTTCAGGCTTGGAAGCCCATGCTTTTACTTACTGAGGCATCTCCA
GTCAAGGCTGCGGTATTTAAAATGACCAAGTTGGGTGAGTGCAATGGCCTAGTGATCAAGAGCACTGGCTGCTCTTCCAT
AGGACACAGATTTGCCCCCAGCACCCACATGGCATCTCACAACCTCTCAGTAACTGTTCTAAGGCATTTTTAGCCCTCTT
CTGATTGCCATTGGCACTGGGCACCANAGGCCAAAAGAGGATGTAAGATTCCCTGGGCTAGGGTTTATAGCCAGTTNANA
GCTGCCATGAGGACNAAGATCCTCTGCAAGANANNCAAATGCTCTTCCCTGCTAAGCCATCTATCTCCCCAGCCGTTAGT
NAGTAGTGGATTACTTCACTTACTNNATCTTCNNCATATAAAAANGGTGAAGGGGGTGNCCTGNAA
Sequence Type genomic DNA
Unitrap ID UNI4919

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3546906..3547367 429
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058503 (5830415L20Rik) NM_001042501 RIKEN cDNA 5830415L20 gene Gene [Source:MGI Symbol;Acc:MGI:1915402]


Sequence tag IST11272E7BBF1
Sequence
GACAGAGAGTACTGACTCTGGAAAGTTGTCTCCTGGCNCACACAACCCCNCACNTACNCNTACAAAAAATTAAAGTGTAA
TAAAAATTACAAAAACAAATACTTTTTGTAANTCACATATTCATATTACATATGACTATAAATGTCTGTGGCTCCAAACT
ACTGTATAANTTCAAGTAAAAGAAAATGATTTGATATTGTAACTNANGGGAATACACACATGTGGAGACACCAANANNGC
ACTGCNNTTTGATGCTAAAGGGATGGGCANACTCTGAGTCATTGCTNTACTTTTACCTAAAGAATGTATNNNNNNGTTAT
CNAAAAGAATATGAAGCAAGCATNCNNAANACAACNGGAACTAANGCACTTTGAGCNTNANNCNNNNANAGATACNNNTG
CANGACTGTAACAAAAGTACTTTGGTCTTGCCANATACTGGTAACANGAGGCTACCNNTGCGTGGGANTGCANGCANGNN
AGCNNTCACACNTGCACAGNAACTCTCTGTCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000058503


For any suggestions or comments, please send an email to unitrap@crg.es