Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12150G3
Clone ID IST12150G3
Vector VICTR76
Project tigm

Sequence tag IST12150G3BBF1
Sequence
TTCCGAAGGTCAGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI8887 UNI26921 UNI32142 UNI32144 UNI32145

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 317891..317958 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 12013080..12013147 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046139 (Patl1) NM_172635 protein associated with topoisomerase II homolog 1 (yeast) Gene [Source:MGI Symbol;Acc:MGI:2147679]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 9952574..9952641 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23511054..23511121 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20832230..20832297 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 37884317..37884384 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022292 (Rrm2b) NM_199476 ribonucleotide reductase M2 B (TP53 inducible) Gene [Source:MGI Symbol;Acc:MGI:2155865]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97870704..97870771 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 37788856..37788923 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53117232..53117299 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 98878947..98879014 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 94716331..94716398 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 81528383..81528450 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34966918..34966985 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 94213103..94213170 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4925442..4925509 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 49308837..49308904 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 118953160..118953227 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 21748616..21748683 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 53991774..53991841 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023092 (Fhl1) NM_001077361 four and a half LIM domains 1 Gene [Source:MGI (curated);Acc:Fhl1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 25197573..25197640 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036646 (Man1b1) NM_001029983 mannosidase, alpha, class 1B, member 1 Gene [Source:MGI (curated);Acc:Man1b1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 93421227..93421294 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034292 (Traf3ip1) NM_028718 TNF receptor-associated factor 3 interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921269]

 
Come back to gene ENSMUSG00000034292


For any suggestions or comments, please send an email to unitrap@crg.es