Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14539H5
Clone ID IST14539H5
Vector VICTR74
Project tigm

Sequence tag IST14539H5HMF1
Sequence
NNNNNACACTCCATGAGAGGGAAACCAGGGAAACAACAACCACGTGGTTTTCATAATTGTACCCCATTTGCATTTCATGC
TGTGAAGCAGGGATCCTCGCCAGCTTCTGAAGCTCCCAAGGCCACCCTGCTTTGTCAGTGCTGAGGCACAAAGATGGGGC
AGCCAAGAGATGAAGGAGGGCTCCTTCTCTTCCAGACTAGGGACAAATAAGCACCACCAGGGTGGGTCTCCATCTCGAAG
GGATTTTTCTGCTAGGCCAAATAACCCAAAGACTCAAGAGACGTATACCTGGTCTGCAATTCACAAGCAAACCCCAAGAA
CCCAACAAACTCAGGAACCTATCTTCTCAACAGGAAGCTGAACATGGCTCTGCACTCACCTCGCTACGATCCACTCAAGA
CACTTGAAAATGGGGCTAGACATTCNCACGGGTGTGTGTGTGTGTGTGTGTGGTTANCANCANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 23220606..23221062 451
 
EST/CDNA Est Name
  BF582930.1 - AI526699.1


Sequence tag IST14539H5HMR1
Sequence
ACCTGAACGACGTTCTCCCCCGACCTCTCCCACCTCCAGTTAATTAGATATCTACTGCACACAGTAATTTCATCGGTTTT
GTTGTTGTTGTTGCTGTTGTTGCTGCTGCTGTTGCGGCGATGTTTAACATAACAAGGCATAGCCTGCATAAGTAGTGTAG
TCTTTTGGGATGAAGGTCTATGTACTTTTTTTCCNAACGATGGTCGGGGCCCTGTTGTTCTGAGAAAGGCAAGGAGCANT
NCNTGCTTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI25831

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95575571..95575822 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075595 (Zfp652) NM_201609 zinc finger protein 652 Gene [Source:MGI (curated);Acc:Zfp652-001]

 
Come back to gene ENSMUSG00000075595


For any suggestions or comments, please send an email to unitrap@crg.es