Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10815A12
Clone ID IST10815A12
Vector VICTR76
Project tigm

Sequence tag IST10815A12BBF1
Sequence
TTTAGGGCCCAGCTGTGTGGCTCTCCAGCTCCCCACACCTGAGGCCCTTGCCATCTGGAAGTGTTAGTCTGGGTTTGTTC
TAAGGCAGATTANATTGCTCCCTTCCCAGGCAGGTGTGGGGAGCCAGCTTTTTCTCAAACTCTCANCAAAGGGATCTCAT
ACATTCCAACACGTGGTGTCTGCTGTTCAGTGAGAGACTTGTCGAGCTCTGCAGGTGTTGGCTGCANACCTGGGTACACT
TGACAACCTANNGCCCTTATTATTCCGGANGAGGGGCTGAGATGTCAGAAATCTTTAAACCNNATCCCCAGGANACTCAN
GTCTGTCTATTGANGCCGGAATATAAACAAAGGAGTGGCTTTATTTGCCNCATCTGCCGTGCCCTANAGCTGACCTTTTG
AGCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI31893

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 37673360..37673767 382
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026090 (2010300C02Rik) RIKEN cDNA 2010300C02 gene Gene [Source:MGI Symbol;Acc:MGI:1919347]


Sequence tag IST10815A12HMR1
Sequence
NNCANCNNATGCTTTGAATCCNTGGCATCACTCTCTTACCCTGGGGAANCTGCCNCNACCCTGCTCAGTGTTCCAGANTC
TGTGAATGTTGGGTGTAAGGAGAGAAGTTTTTGTAGGGCTGGAGATCAAAGATGAGGACCCCAATCCACAGGTGCCANAG
GGCCCTAAGTTTCTACAGACTTCTGCCTCTGAT
Sequence Type genomic DNA
Unitrap ID UNI5712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55067023..55067207 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]

 
Come back to gene ENSMUSG00000060206


For any suggestions or comments, please send an email to unitrap@crg.es