Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11838A4
Clone ID IST11838A4
Vector VICTR76
Project tigm

Sequence tag IST11838A4HMF1
Sequence
TAAGGACGGGAAGGAAATTAAGCCGTCTAAAAACGTTGTTATCAAGA
Sequence Type genomic DNA
Unitrap ID UNI35827

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 76646920..76646965 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051747 (Ttn) NM_011652 titin Gene [Source:MGI (curated);Acc:Ttn-019]


Sequence tag IST11838A4BBF1
Sequence
TAAGGACGGGAAGGAAATTAAGCCGTCTAAAAACGTTGTTATCAAGGCTGACGGCAAGAAACGCATGCTGATCCTGAAGA
AGGCCTTGAAATCAGATATCGGCCAATATACCTGTGACTGTGGGACAGACCANACCTCTGGGAAGCTGGACATTGAAGGT
GAGGAAATTTCCATGAGTCTCCTCCTAGAAGCCATGGGAGTCATTTCTGCCAGAGACTAATGACNCATGATGACCCTTCA
TTTTTTCANATCGGGAAATTAAACTGGTGCGACCCCTGTACAGCGTGGAGGTGATGGANACCGANACGGCCCGCTTTGAA
ACTGANATCTG
Sequence Type genomic DNA
Unitrap ID UNI35899

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 76646636..76646965 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051747 (Ttn) NM_011652 titin Gene [Source:MGI (curated);Acc:Ttn-019]

 
Come back to gene ENSMUSG00000051747


For any suggestions or comments, please send an email to unitrap@crg.es