Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12966E11
Clone ID IST12966E11
Vector VICTR76
Project tigm

Sequence tag IST12966E11BBF1
Sequence
AAATGAACATAAATAAAATCTTTTTTTTTAAACTGAANCAGGCCAGGTGTGGTGACACAGGCCTTTGACCCTANTACATA
AGCGACAGTCCAGCCTAGGCTACATAGTAANACCCCGTCTTAACCAAAACAAAAACAAACCAAACTCCAAAGCGGGTGGG
CTGTATGTCANTGATGGGGCTTGCCCGGGGAAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI19062

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7818487..7818683 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031171 (Ftsj1) NM_133991 FtsJ homolog 1 (E. coli) Gene [Source:MGI (curated);Acc:Ftsj1-001]


Sequence tag IST12966E11HMF1
Sequence
AAATGAACATAAATAAAATCTTTTTTTTTAAACTGAAGCAGGCCAGGTGTGGTGACACAGGCCTTTGACCCTAGTACATA
ANCGACAGTCCAGCCTAGGCTACATAGTAAAACCCCGTCTTAANCAAAACAAAAACAAACCAAACTCCAAAGCGGGTGGG
CTGTATGTCAGTGATGGGGCTTGCCCGGGGAAGGATCCANANATGAAGTANAAGGAAAAGACTCCCTGCCAAGCCCAATG
GA
Sequence Type genomic DNA
Unitrap ID UNI19062

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7818443..7818683 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031171 (Ftsj1) NM_133991 FtsJ homolog 1 (E. coli) Gene [Source:MGI (curated);Acc:Ftsj1-001]

 
Come back to gene ENSMUSG00000031171


For any suggestions or comments, please send an email to unitrap@crg.es