Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DC0787
Clone ID DC0787
Vector pGT1lxr
Project sanger

Sequence tag DC0787
Sequence
GATGAAGAAGAGGAAGGGCTGGAGGACGATGCAGACCCTCTGACAGAGCTGCAGGAGGTCCTGGGTGAGGATGAAGAAGC
GGGTCTGCTGGACGGCAGTGAGGCAGCAAGTCCAGACCTCTGTGAGGAGAAGACTTGGGACAACACTGAACTACCTGTAG
AGCAGGCAGCCTGCCAACAGGCAGTACCTGCTGCAGCTCAGGCTGGAGGGCCTCGGGGGCTGCAGGCTTTGCTGGAGGAA
CGGATCCGTAACTACCGGGAGGCCGCAGCCAGTGCCAAGGAGGCTGGTGAAGCTGCCAAAGCCCGGCGCTGTGAGCGAGG
CCTAAAGACTCTGCAGTCCCAGCTTGCCACTGTGAGGAAAGGCGGGAAGATCTGTGAGGATGGGATCCCACCTCCAGTAG
CCTTGGGCAAAAGGCCCCCAGCCCCCCAGGAAAGAGCCATCAAGAACCCTGAGATAGACTCTCCAGGTCTCTGTGCCATG
GAGCCAG
Sequence Type mRNA
Unitrap ID UNI3128

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108297111..108298419 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028582 (Cc2d1b) NM_177045 coiled-coil and C2 domain containing 1B Gene [Source:MGI (curated);Acc:Cc2d1b-001]

 
Come back to gene ENSMUSG00000028582


For any suggestions or comments, please send an email to unitrap@crg.es