Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11816A1
Clone ID IST11816A1
Vector VICTR76
Project tigm

Sequence tag IST11816A1HMF1
Sequence
CAAGCAAGCAAGCAAGCAAACAAACAAACAAACAG
Sequence Type genomic DNA
Unitrap ID UNI35901

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 24212014..24212048 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 43191663..43191697 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 11005090..11005124 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 67066788..67066822 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 126780122..126780156 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 76167782..76167816 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075270 (Pde11a) NM_001081033 phosphodiesterase 11A Gene [Source:MGI (curated);Acc:Pde11a-001]

 
Come back to gene ENSMUSG00000075270


For any suggestions or comments, please send an email to unitrap@crg.es