Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15057B3
Clone ID IST15057B3
Vector VICTR80
Project tigm

Sequence tag IST15057B3HMR1
Sequence
TTGAAATGCATGAAACAAAATACCACACCAGACTAATGTGGGTAGAAGGATGAGAAGGGAGACGGGCTGTTGTTTTTATA
AACTGTAATGTCAAACGGTATAGCTGTGAATTCACCTCAAGCTTTACCATTTCGTTCCCACAGTAAGAACTTCGTTCCCA
CAGTAAGAACTACATTCTCGGGGGGCTGTCCTCTCAGAATGGGGAAGAAGAAAGAATGTCCTCGGCAGGTTCCCTCCAAA
CCACATGCCTGGAGGCCGGGCCCATATTTCTCAGAAAGAGGCTGGGCCAGCCTCCACTCCCGAATCTTAATCTCATACAC
CCACTGGCAAGCTGCAGTTGTTTTTGTAAAAATTCCCTTCTCGTGGCACACAAATTTAACTTAGGCTGGATCGCTGGACN
AACCGTGAGTCTTTTAAGTGGAGACAAACATGACTTATATTAAAAGGAACCACAAAAACGTTTACAGAAATAACCAGGAA
TGTANGTTTTTAAAAGTCNAGACAAAACGGCACAGTCNCAGAATTTAANANCTTGCTNNCACCATTTAAAGGCTTAAATN
ATAGCTNGNGCGTNNNTTCTGNNTANTTTCNCAGCNCANNANTGNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 121225070..121225667 560
 
EST/CDNA Est Name
  BI111987.1 - CK792298.1 - CF551034.1 - BG080845.2 - DV662515.1 - CA539801.1 - CA538649.1 - AA673838.1 - BI251202.1 - AA522428.1 - BF134342.1 - AA616431.1 - BB624948.1 - BG807624.1 - BI662640.1 - BE281787.1 - BY250869.1 - BQ884541.1 - BE137478.1 - CJ083563


Sequence tag IST15057B3BBF1
Sequence
CAAGAAATGGTCATCTGTTCTTGTGCTTGTGTTTTCGATGCTGAAATGTAAAGTTCAGAAATTACACCACCAGCCGCAGG
CAGGAAGCGTCCCACAAGTATCTGCTGAATGAATGAATTTAGTGTGCTGTGGATACTCTGTGTGTGTGTGTGTATACACG
TACACACATCCANTANTATGTGTGTGTGCCCGTGGAGACCANAGGCCAATGTCAGGTGTTTTCTTCTATTGCTGTGTTTT
GACATAAAACCTTTCACTGANCCCTTANCTTGCCCTGATGGCTACCCTGACTGACNAGCGAGGAGCTGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI2855

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 121224760..121225072 299
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055723 (Rras2) NM_025846 related RAS viral (r-ras) oncogene homolog 2 Gene [Source:MGI Symbol;Acc:MGI:1914172]

 
Come back to gene ENSMUSG00000055723


For any suggestions or comments, please send an email to unitrap@crg.es