Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14239A9
Clone ID IST14239A9
Vector VICTR74
Project tigm

Sequence tag IST14239A9HMR1
Sequence
ANGCATCTCTTGAATTCTANCAAGGAGGGTCCTTGTGGAAAGCCCTACACACTACGTTGGATACTGACCCTTTGTGTGTC
CCAGAGTACCACTGCCTGTCAATCATGTCCCTCACTGCTGCCTCCTGAGCCTCCACCCTGCTTTCTTTGATGTCTTCCTC
CTGGTTTGTTAAGGTANCTGTGTTTCCTGACCTGGAAGAAAGCCTCCTACCCANTGTCNTANCTGTTGTANTTTTGTCTC
CTTCTGTANCCCANGATTAACTTNNNCCTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI16024

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57311049..57311328 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040722 (Scamp5) NM_020270 secretory carrier membrane protein 5 Gene [Source:MGI Symbol;Acc:MGI:1928948]

 
Come back to gene ENSMUSG00000040722


For any suggestions or comments, please send an email to unitrap@crg.es