Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15059D11
Clone ID IST15059D11
Vector VICTR80
Project tigm

Sequence tag IST15059D11HMR1
Sequence
TTTTCAAGACAGGGTTTCTCTGTATAGCCCTGACTGTCCTGGAACTCACTTTGCAGACCAGGCTGGCCTCAAACTCANAA
Sequence Type genomic DNA
Unitrap ID UNI3432 UNI30261 UNI35902

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 78560345..78560424 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 99599536..99599615 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 38911110..38911189 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 128630356..128630435 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87682853..87682932 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004895 (Prcc) NM_033573 papillary renal cell carcinoma (translocation-associated) Gene [Source:MGI Symbol;Acc:MGI:2137738]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108261275..108261354 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013150 (Gfod2) NM_027469 glucose-fructose oxidoreductase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917825]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 138055689..138055768 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031274 (Col4a5) NM_007736 collagen, type IV, alpha 5 Gene [Source:MGI (curated);Acc:Col4a5-001]

 
Come back to gene ENSMUSG00000031274


For any suggestions or comments, please send an email to unitrap@crg.es