Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14387H10
Clone ID IST14387H10
Vector VICTR74
Project tigm

Sequence tag IST14387H10HMF1
Sequence
TGATGAAGCAGCTCTGTTTCAATATGTTTATCTGCAATACACAAGAAATCAGTAACCCCTTAAAACTGCTAAGCATGAGG
TTAAATTTTAAAATTATTAAAATGAGTAATGCANNNNNNGCAGAAATTTATTAAGGTAACTTGCCTTTTTGATAGTTCCA
AGATAAAACAAGCCATCTGACCATCTAGCTAAGACATCTTGACCCTCTTCAAATTTACATGCTGGTTTTTTGGCTTTATG
TCCATCCTGTAAAGACAGCTTGTTCAAGGATGCTGAGGTCTTTTGGTTTCGACGTAAAGGAGACCGCTTGTGGACCAGTG
AATTACCTGCTCCTGTAGAGTCTCTGTTCAGGAAATAGACCAAATAGAAGACGTATAAGATTTTATACCAGATAAATCTC
ACATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108509780..108510186 395
 
EST/CDNA Est Name
  CF895920.1 - DT912388.1 - CK137799.1 - CK137781.1


Sequence tag IST14387H10HMR1
Sequence
ATCNTATTTGAGGACAGTTCCAAATCCTGGGTTCTCTGGAAGGACATCCAAACAGGCAGGTGCTATGTTACTCTTGAACA
TGATTGATATCGAAACTTAGTTTTCTTCAACATGACTTTTTCTGATGCCAGTGATACTGAATATACTGTTCTTCAGTGGC
TGG
Sequence Type genomic DNA
Unitrap ID UNI17974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108510183..108510345 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es