Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13635D6
Clone ID IST13635D6
Vector VICTR74
Project tigm

Sequence tag IST13635D6HMF1
Sequence
CTACATCTTGCTTTTATGCTATCCCTATATGCTATCCCTATTCCCAAAGCCTCTAACCCTCTCCTCATTCTCTACTAANT
CCTCTTCTCTTCTATGTCCTGCCTACTTGGCCNGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 22895950..22896061 110
NO GENE  


Sequence tag IST13635D6HMR1
Sequence
GTAGTTGCTAGAGATTCCTGGTATCATTGCAGATCCACCAGAATTTGCCACTGGAAGAATAAGATTTAATATGGCGGGGC
TGGCGAGATGGCTCAGTGGTTAAGAGCGCTGACTGCTCTTCCAAAGATCCTGAGTTCAAATCCCAGCAACCACATGGTGG
CTCACAACCATCCATAACGAAATCTGATGCCCTCTTCTGGAGTGTCTGACGACAGGTACAGTGTATTTACATATAATAAA
TAAATTTTAAAAATATTAAAAAAAAGATTTAATATGGCTTACAAGATTAGGTTTTANATGTTGCACCCAGTGATTGTGTT
ACCATTGTTT
Sequence Type genomic DNA
Unitrap ID UNI2640

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 22895624..22895953 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036782 (Klhl13) NM_026167 kelch-like 13 (Drosophila) Gene [Source:MGI (curated);Acc:Klhl13-001]


Sequence tag IST13635D6BBF1
Sequence
CTACATCTTGCTTTTATGCTATCCCTATATGCTATCCCTATTCCCAAAGCCTCTAACCCTCTCCTCATTCTCTACTAAGT
CCTCTTCTCTTCTATGTCCTGCCTACTTGGCCAGTGGTTGGCTCCTTTATTCATTAGGAGATTGGTTCACAAGAAGTCAC
CTGAGTACTTGACTACTCCTTGTCCAAAGCCCCTCCCANAAAAGGAGAATTAGCATCAAAATACAAACAGCACCAGGCCC
ATCTACAACACCTCTCAATGTCAATGAACTTAATTCTCCAATAAAAAGACACAGGCCAACAGAAAGAGGCAAACAAAGGA
TCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 22895950..22896271 318
 
EST/CDNA Est Name
  BB861410.1 - CJ086512.1

 
Come back to gene BB861410.1 - CJ086512.1


For any suggestions or comments, please send an email to unitrap@crg.es