Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10437E6
Clone ID IST10437E6
Vector VICTR76
Project tigm

Sequence tag IST10437E6BBF1
Sequence
NAAAAGAGACCTANAAAGCAGTAAATAAATGTTCTTACTGCTTGTTGCTGAAGATCCATAACTAACATGTGCTTCCCTTC
CTGGCANAAAACAATGGCCTGCTGTTCCTGGAGACGTCAGCCCTCGACTCCACCAATGTTGAGCTANCCTTCCAGACTGT
CCTCAAAGGTGAGAGAGCCTGCCCATTGGGTACTTACTCCATTCTGGGTGGGACCCTGTCCTAACTCACTGTGGCCTCTA
GCCTGCTCCGAGCCACTGGTCCCACCTCCCATCTCTCCNCTCATCCTAGGGCTGAGGGAAGCAACCGGANGGCCTCATGT
TTTANGGGACTGANTCTGGGTTCCTTGTTTACCCANGAAGATAGACAAGACCCANGTATCAAGACTACTTTGTTCCAGCA
AAAACACTTCCTCANGGTGGCCACCTGTGCTCCAAACAGTGTGTCACTANGGGGCGGGACATTAAACTTCTGGCCTGANT
ATTTCCCTCTGTCCTTAGAGATNTG
Sequence Type genomic DNA
Unitrap ID UNI29076

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88346289..88346789 477
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008601 (Rab25) NM_016899 roadblock domain containing 3 Gene [Source:MGI (curated);Acc:Rab25-001]


Sequence tag IST10437E6HMF1
Sequence
NAAAAGAGACCTANAAAGCAGTAAATAAATGTTCTTACTGCTTGTTGCTGAAGATCCATAACTAACATGTGCTTCCCTTC
CTGGCAGAAAACAATGGCCTGCTGTTCCTGGAGACGTCAGCCCTCGACTCCACCAATGTTGAGCTAGCCTTCCAGACTGT
CCTCAAAGGTGAGAGAGCCTGCCCATTGGGTACTTACTCCATTCTGGGTGGGACCCTGTCCTAACTCACTGTGGCCTCTA
GCCTGCTCCGAGCCACTGGTCCCACCTCCCATCTCTCCACTCATCCTAGGGCTGAGGGAAGCAACCGGANGGCCTCATGT
TTTANGGGACTGANTCTGGGTTCCTTGTTTACCCANGAAGATAGACAAGACCCANGTATCNAGACTACTTTGTTCCNNCA
AAAACACTTCCTCANGGTGGA
Sequence Type genomic DNA
Unitrap ID UNI29076

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88346371..88346789 399
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008601 (Rab25) NM_016899 roadblock domain containing 3 Gene [Source:MGI (curated);Acc:Rab25-001]

 
Come back to gene ENSMUSG00000008601


For any suggestions or comments, please send an email to unitrap@crg.es