Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13057A5
Clone ID IST13057A5
Vector VICTR76
Project tigm

Sequence tag IST13057A5BBF1
Sequence
TTCTAATAGGCGGAGGACTTATACCATCTCAAGAGGGACAGAGGATAATCGTTCTGGTTTTCTGAGTGTCAAATACTATT
TGTGCCCAGTTAACACGAGTCATCACCCTTTAAACACTTTCCAGTTAGACAATATTTTCACTCATCTCTTACGATTGATT
AAGTATTGTAACCGACAGGGGCTAATACCCTTTGAAAAAAATCTTAAAATAATCCTCTGAAACGGGACATGGCTGTGCAT
GCCTGANATACCGGCATTCAAGANACTGAGACACTAAGACCACTAGTTCGAAGTCCGCCTAAGCTACATAGTANGAACCT
GNCTTAAATANNCNAGTNAATAAACNATGCGACTCTGCCNNGNNNNCTGANATTNAAACTACAGAAAATCTANTCTGNAA
AAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13057A5HMR1
Sequence
GAAAACGAGACGTTTAATAGAAATGAGAGCAACAAGGAAGTACTGATGATGTTCTCCACTTACTGTGTTGGAGGCTTTGT
TC
Sequence Type genomic DNA
Unitrap ID UNI23934

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 100980130..100980210 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066415 (Msl2l1) male-specific lethal 2-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1925103]

 
Come back to gene ENSMUSG00000066415


For any suggestions or comments, please send an email to unitrap@crg.es