Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10324H7
Clone ID IST10324H7
Vector VICTR76
Project tigm

Sequence tag IST10324H7BBF1
Sequence
ATACACACTACTGATTAAAGGATAACTGTTTAAAAATAAGGACTTGAGCTGGAGGTGGGGGTGCACCCCTTTAATCCCAG
CACTCAGGAGGCAGAGACAGGAGGCTCTCTGTGAGTTCAAGGCCAGTGTAGCCTACAAAGGGAACTCCAGAACACCCAGG
GATACCCAAAGAAACTGTCTNANAAAATCCAAAACCAAATANATGATGATACNACGACNATGATGACNATGATGACNATG
ATGGCANAGGTGGCAGCGGTGGCATGATAATAAAAATAANCACTTGAGGTTGTTTGNANAAACATGTACCTGGAGTTGAA
GATGTCCCTCCCTGTAGTTGTAACACTAANCAGATATTGCTCAACCNNGAACAGGCNNTACCCTANNGCTCTTCTCTATG
ACCAGAAAAGANAATATCNGTTCAACGAACACTTAAAGATTTAGCCTCTTGATTATTACATCTCTGGGCTAACTAGTCAC
CCCGTANTCACCATCCACAGTGNTGAAACTNANTGTCTAGAANTTGGNANTNNTCCNCCCCGCCTCGCGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10324H7HMF2
Sequence
TGGCAAAGTCATGAACCTCTGTTAGAAAATTGTTTTTCTCCCTTGCCTTCCTTCTTCTCTGACGTTCACCATCCTTCTTT
CTTTCCCAGGTGAGAATTACAGTTAGTTATCTTTTCCATAGTCGAGGAATATGGGTTTTGGTAAAGATGGTGACCCCCAC
GGAGCACCCATTAAAGCCAACTGTGAATGCTCTCANAGCCTGGANAAACTACCATGCTCCTGCAGTGGCTGGAAAGGGTC
CANAATAGGTCCTGCTGTGTANTCCAGGCTTTAAAGCCAGCCTCTTGTCTGTGTANATAAAGCANGACAGACAGTTTTCT
ATTTACAGACCNNAAACAGCCCATCTAGAGCCTTAGTGGCTTCTGGTATTCAATAGCTGTGGTGTCTTCCCTTTGGCTGG
TGTGATGGTGGTGGTCTATGGTGGTGGTGATGGTGGTGGTCGCCATGGTCCTGANGATCAAACGGANGGACTTGTGCATG
TGNNAACGTGTTCTATCACTGNATGTCCNCATAAACCTCAGTTCTGTGTTTNTAACATTCTTNATTCCTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20317410..20317960 515
NO GENE  


Sequence tag IST10324H7HMR1
Sequence
CCNGGCCCATGTTAGACAGGGCTCCAAGGCAGACTGCGCCCAACTTGTANCTCACACTTANCATTAANGAAAAACCAGTA
TCAAAAGCAACTCTGGGAGGCTCCCTCTAACACACTCCAGAGGCTTACCATGGGTTACACAAGTCTATCTGCTGCTTCCA
GGAAGATGGTCTTGTGTTATCCCTTGGAGGAGGATGGCTTANCACTTCCACCTTCTTTGTCTGCCCACAAAGGGAGACTT
AATTTGGTTTCCCTGTGCTTTGCTGGACATTGCATGCTACCTGACAAGGGTGTGCNANCAAGTGCTGCCGATCCCTGANC
GCTTTGGGCAGCCCTTTCNTTNNTCTTCCTGCTCTCCCNCTCCTANTTC
Sequence Type genomic DNA
Unitrap ID UNI31842

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20317958..20318325 342
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es