Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13663H9
Clone ID IST13663H9
Vector VICTR74
Project tigm

Sequence tag IST13663H9HMR1
Sequence
NNGNNNNNTTNNNCCNTGCTNNNCNGANNATTTGAAATGACTNTTGNGGTTGATTGAGGCCTGGAATGTTTAGGAGGGAG
AGAAGAATCCATCTAATTCATGAACATCTTGTGGAGGATATTCATATGTAGTAGCACAGGACTGTAATCTTGGTACTTGG
GATGTGGTGATGGGAAAATGGTGAATATGAGGCCATCCTGGGTTACATAACAAGACCCTGCTTCAGAAAACCAAAACAAC
AAAC
Sequence Type genomic DNA
Unitrap ID UNI16201

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34939640..34939853 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]


Sequence tag IST13663H9BBF1
Sequence
TCCTGTATAAAGCATGTTATTCTTACTTCCCTTGTAGCAACCTTCCAACAAGGCCAGAGCCTCTGTAAAAATACTTGCTG
CTTAACAGGCCCAGGGAAGAACAGAGGAAATACATTTCTAGCTAATTTTTTAAATGAACACTTGGAAAGCATTTCTTATA
CACCAAGGCCTCAATTAAGACTTTGTTCTTGGTCAGGCAGTGGCTCACACTTTTAATCCCAGCAAAAGCAGGTGGATCTC
TGANTTNAAAGCCAGCCTGGTCTACAGAGCAAGTTCCAGGACAGCCAGAGCCNCACAGAGAAACCTTGTCTCAAAAAAAA
GGAAAAAGANNANANNNTCAAANCAAGACTTTGTTCTTNNGTGAATGCTGCTACAAGGGACANCAGGATTGNTTTTTTTT
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34939215..34939614 372
NO GENE  

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es