Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST455874
Clone ID OST455874
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST455874
Sequence
TCGAAGCATTCAGTCAAGTGGTGGCAAGGCAGAGCCACCAGTAAGAGGGCACCTAGNTTCCATGACAAATATGGGAATGC
TNTATTANGCATGGTGGAGCCATCTTCTGTGTTTCTACATGGACATATACAGCCACACAAATTGGAATAGAATGGAACAT
GTCCCCTGTTGGCATGAGTCACCCCAAAGGAATGGAGAGATCAGTAGTCTGTGCCAGCTGGTACAATAATCAAGGAATTG
TTTAAAACCAACTTATAAGTGAATGCCAAGTCAAAGAATCATGTACTCATTATACTATGGCAGATTGAAGAACAAATAAA
GAAATAAAGTACCTTAACCTTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16634

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 103214919..103217297 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031231 (Cox7b) NM_025379 cytochrome c oxidase subunit VIIb Gene [Source:MGI (curated);Acc:Cox7b-001]

 
Come back to gene ENSMUSG00000031231


For any suggestions or comments, please send an email to unitrap@crg.es