Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14758H9
Clone ID IST14758H9
Vector VICTR76
Project tigm

Sequence tag IST14758H9HMF1
Sequence
ACAGATGGTTAAGCCTACAGGTGCAAAGCCTTCTGACACAGGGCTGGCTGCCACATGCGGGATTCAGACAGGATTTTCAA
CAACCCAACTTACTAGAGGACCCATGAGAGAAGACAGTAACCCAGGAGTCCCTCCAGAGGCCCGGAACCCAGGACAGACC
TCAACTGAAGTAACGCCTCG
Sequence Type genomic DNA
Unitrap ID UNI22292

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 60697104..60697274 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059901 (Adamts14) NM_001081127 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 14 Gene [Source:MGI (curated);Acc:Adamts14-001]

 
Come back to gene ENSMUSG00000059901


For any suggestions or comments, please send an email to unitrap@crg.es