Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15091F2
Clone ID IST15091F2
Vector VICTR80
Project tigm

Sequence tag IST15091F2HMR1
Sequence
GTTATTTCTNATTACAGCCNACAAAGCAAGTTACTTGGTCAGTATTGGCCAGGCTAGAGTATCCAAAGCCTGGGCCTGGG
GGCTGTTCATGACACGGAGATGTGGAGGGCCTTCCTCTGCATCTATTGCCAGTTACTGTGAGAGCCAGCTTTCAGCCTTA
GCAAGAAGCCTCTGTGTCCTTGGGTGCAGAGCAACATTCACAGTTTCCTAAGGGACAGTCCCAAGAACTAGCATATACCT
CGGTTGCCTTTCCAACTGCTCTGTGTTTAGTCCTGGGGTGGTTAAGGGGACAAGACCCAACTTCCAGCAAGGACCCGGTC
TGGCCTAGAAGGGATGCCAGGCCTGAGGAGAGATCATTCTAATGGACGAAGGAGAGACAGCAGCTAGAGAAGGCCAAGGC
TTCCTAGACGATGTAGCTGCNGCGATCGATCGGGGATTCTGGAAAGGATGCAAGCCTAGTCGAGGCTCCTGGAGTCAAAG
GAGCCTGANGTCNCACGANAAAANAGAAGGGGAAAATTGAGTGGTTTTTGCTTGGTTGTNNTGGNGGG
Sequence Type genomic DNA
Unitrap ID UNI35815

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116485811..116486355 519
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020806 (Rhbdf2) NM_172572 rhomboid 5 homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Rhbdf2-001]

 
Come back to gene ENSMUSG00000020806


For any suggestions or comments, please send an email to unitrap@crg.es