Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14873G10
Clone ID IST14873G10
Vector VICTR76
Project tigm

Sequence tag IST14873G10HMF2
Sequence
CCCCGACTAGTTTCTAAAAGCAGGCGACTTCTCAAGTCCAACTACAGGGAGTTATCAATGATTGACAAGTATTATTTTCT
TTGATCATAAGGGTCATAGCAGGAGTAGGTAATGAGACTTTGCCCCTTGAGTTTCCTGGGAACTGTTTTCTCTCTTGAAC
AACAAGCAAACAGCACAGGCAAGGGGCCATGTTGCAACCAGGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76346650..76346856 207
 
EST/CDNA Est Name
  AI647209.1 - CD803828.1


Sequence tag IST14873G10BBF1
Sequence
TAACCACTGACCCTTCCAACAACTCAAAACATGGGAAGATTCTAATACCCTCTATGCAGCCTAAAAATTTGGTTCTCAGG
TTTCTCGCCAGAGACCCAAAATCATCAGAACCTACTAGCACAGGCTGTTTGCTACTTTACAAGCTTGTCAANAANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72656962..72657120 155
NO GENE  


Sequence tag IST14873G10HMR1
Sequence
GGGGGAGGACACCAGTGTTGCGATTTGTGAANACTACAGTTTTGTTGATTACTAGAATCTGTGTTGTATGATCACAAAAT
ACCATCGTGTTTAGGCNTGACGCTTTTCTAGTGTTTGTTTGTGCTTTGTGGCTAGAGACCTCAAAAGCCNAANGANTTC
Sequence Type genomic DNA
Unitrap ID UNI15400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76346496..76346653 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048490 (Nrip1) NM_173440 nuclear receptor interacting protein 1 Gene [Source:MGI (curated);Acc:Nrip1-001]

 
Come back to gene ENSMUSG00000048490


For any suggestions or comments, please send an email to unitrap@crg.es