Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DB0003
Clone ID DB0003
Vector pGT1lxr
Project sanger

Sequence tag DB0003
Sequence
ACCCTCATGACGAGTTCTTCACTTCTGGCTACATCCCCGCCCGTCTCCCTATTACCTGCCTCACCATCCCACCAAGGTTT
TCAATCGCTCCCAGCAGCCTGGACCCCAGCAGCAGGAAACCTCTCAAAGTCCTCAATAAAGGTGTGGAGAACCCCCTGCC
TGACCGTCCCCGGGAGAAAGAGGAACCGGTGGTCCGGGAGACAAATGAGGCCATTGAGTGCCACCTTAGTGACTTGCTAC
AGCAGCTGACCAGTGTCAACGCCTCCAAGCCCTCGGAGCGCGGGCTGGTGCGGCAAGAGGAGGCTGAGGATCCTGCCTGC
ATCCCCATCTTCTGGGTCAGCAAGTGGGTGGACTATTCGGACAAGTATGGCCTTGGGTATCAGCTGTGTGACAACAGTGT
GGGGGTGCTTTTTAATGACTCAACACGCCTGATTCTCTACAATGACGGGGACAGCCTGCAGTACATAGAGCGTGATGGCA
CGGAGTCCTATCTC
Sequence Type mRNA
Unitrap ID UNI3133

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 129307619..129312461 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030867 (Plk1) NM_011121 polo-like kinase 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97621]

 
Come back to gene ENSMUSG00000030867


For any suggestions or comments, please send an email to unitrap@crg.es