Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10140D6
Clone ID IST10140D6
Vector VICTR76
Project tigm

Sequence tag IST10140D6HMF1
Sequence
GCTTTGTGGGTTATAGTTCTTCTGCCAATGAGAACCCCAGGACCAACGCATGAACTTGAGCCTGGAAGTAATTGAGAAGA
AACAGGGTTCATGACCATAATCCCGGCACTCAGGGTTGCTGTGAGTTTCAGGCCAGCCTGANCANCAAACAAACAAAAAA
GAAAAAGAAAGGAAATATTTGAGAGGAAGGGATCAAAGGAAGTGAGAGAGAAAACATANNAACGATTCTATTCTTATTTT
TATATTTAATAAAGAGCTGTGATAAACATCTGTACAATCAATGCACAGAGTTAGGCCTCACTTCCTTGTGGACCAACTAT
CCATACATTAAATATTTGTTTANCATTCCTAGTGTTAGGCACCGTGCCCAGCCCTANGAAAGACAGATGGAAAGAGAACT
GTCCTANGGGAACCGTCCTATCTCGCANGGGGACACAAGCAATAGTCCTCTCATGAGATAACAATNCAGCCTGGCCACAA
AACAGTCNNATGTTNATCAGANCTAACTTCATTTGACNNGAGAATANGGTTTTCTTTAANGTTGCATATACN
Sequence Type genomic DNA
Unitrap ID UNI30557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117086505..117087055 517
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST10140D6BBF1
Sequence
GCTTTGTGGGTTATAGTTCTTCTGCCAATGAGAACCCCAGGACCAACGCATGAACTTGAGCCTGGAAGTAATTGAGAAGA
AACAGGGTTCATGACCATAATCCCGGCACTCAGGGTTGCTGTGAGTTTCAGGCCAGCCTGAGCAGCAAACAAACAAAAAA
GAAAANNNAAGGAAATNTTTGAGAGGAAGGGATCAAAGGAAGTGAGAGAGAAAACATANNAACGATTCNNNTCTTATTTT
TATATTTAATAAAGAGCTGTGATAAACATCTGTACAATCAATGCACAGAGTTAGGCCTCACTTTCCTTGTGGACCANNNN
NNCATACATTAAATATTTGTTTAGCATTCCTAGTGTTAGGCACCGTGCCCANCCNTANGAANGACAGATGGAAAGAGAAC
TGTCCTANGGGAACCGTCCTATCTCGCANGGGGACACAAGCAATAGTCCTCTCATGAGATAACNATCCAGCCTGGCCACA
AAACAGTCCNATGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es