Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12509B11
Clone ID IST12509B11
Vector VICTR76
Project tigm

Sequence tag IST12509B11BBF1
Sequence
AGCTCAGCAGTTAAGAGCACTTCTTGCTCCTGTAGAGGACCTGAATTCAGTTCCAAGCACCCACACGGCAGCTCACAGCC
ATCTTTAACTACAGTTCCAGGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41605882..41605987 106
NO GENE  


Sequence tag IST12509B11HMF1
Sequence
GTGACCATGGGCTTTCTTGTGGTCCATTTTCAGAGAACTACAGAATGAAGTCCTTAGTTTGGA
Sequence Type genomic DNA
Unitrap ID UNI18413

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116992085..116992146 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020823 (Sec14l1) NM_028777 SEC14-like 1 (S. cerevisiae) Gene [Source:MGI (curated);Acc:Sec14l1-007]

 
Come back to gene ENSMUSG00000020823


For any suggestions or comments, please send an email to unitrap@crg.es