Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10984G3
Clone ID IST10984G3
Vector VICTR76
Project tigm

Sequence tag IST10984G3HMF1
Sequence
TTTATTTGCTGTTTATAAATTTTAATTGGTATTTTTGAGACAAACATGGGCTGGTCTANAAGTTACTATGTAGCCCAGGC
TGACCTTAAACTTGAACTTACAACAGTCCTCCTGCATCANCCTCCCAAGTGCTGGAATTATAACTATGAACCATCAAACC
TAGCTTTGTACAGTACTAGGCAGCCACTTAAGGAATTCTGANCAAGGACTGTTCCACCAAGCTGCACTCCATTTGTTTGT
TTGTGACAAGGCCTCATGTANCCCGGGCTTGCCTTAANCTCACTACATAGCTGACGATGACCTTGAACTCCTTATACTCC
TGCTTTCACTTCCCACATGCTGGGATNNCNAGTACCACCATTCCCACCTCCNAATTTTNAAATTTGAATCTGAAGCNNNG
TCTTGCANAGTTGCCCANGCTGACCTTGAACTTTTGATCTTCCTGCCTCAGCATGTACCTACNATGTAAACCTAANTTTA
CAACAATAACAGAANAACTACTTGTTGTAATTNANGCTATATGGATGTGTTTTTCCTCTCTTCTN

Sequence Type genomic DNA
Unitrap ID UNI31488

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 41549651..41550194 504
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038332 (Sesn1) NM_001013370 sestrin 1 Gene [Source:MGI (curated);Acc:Sesn1-001]

 
Come back to gene ENSMUSG00000038332


For any suggestions or comments, please send an email to unitrap@crg.es