Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13255H7
Clone ID IST13255H7
Vector VICTR74
Project tigm

Sequence tag IST13255H7HMF1
Sequence
CTCAAAGGTACTANAAAACCAAACAAACCAAACCTGAAAGGGCTAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22300219..22300268 48
NO GENE  


Sequence tag IST13255H7BBF1
Sequence
ATGGCATTTCTACCAAATGTGATTTATCAATTGTAGTTGTATATTCTTCATATCTAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI29790

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11843741..11843802 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020176 (Grb10) NM_010345 growth factor receptor bound protein 10 Gene [Source:MGI (curated);Acc:Grb10-005]

 
Come back to gene ENSMUSG00000020176


For any suggestions or comments, please send an email to unitrap@crg.es